class Bio::Sequence::NA
DESCRIPTION¶ ↑
Bio::Sequence::NA represents a bare Nucleic Acid sequence in bioruby.
USAGE¶ ↑
# Create a Nucleic Acid sequence. dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA') rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa') # What are the names of all the bases? puts dna.names puts rna.names # What is the GC percentage? puts dna.gc_percent puts rna.gc_percent # What is the molecular weight? puts dna.molecular_weight puts rna.molecular_weight # What is the reverse complement? puts dna.reverse_complement puts dna.complement # Is this sequence DNA or RNA? puts dna.rna? # Translate my sequence (see method docs for many options) puts dna.translate puts rna.translate
Public Class Methods
Generate an nucleic acid sequence object from a string.
s = Bio::Sequence::NA.new("aagcttggaccgttgaagt")
or maybe (if you have an nucleic acid sequence in a file)
s = Bio::Sequence:NA.new(File.open('dna.txt').read)
Nucleic Acid sequences are always all lowercase in bioruby
s = Bio::Sequence::NA.new("AAGcTtGG") puts s #=> "aagcttgg"
Whitespace is stripped from the sequence
seq = Bio::Sequence::NA.new("atg\nggg\ttt\r gc") puts s #=> "atggggttgc"
Arguments:
-
(required) str: String
- Returns
-
Bio::Sequence::NA object
# File lib/bio/sequence/na.rb, line 75 def initialize(str) super self.downcase! self.tr!(" \t\n\r",'') end
Generate a new random sequence with the given frequency of bases. The sequence length is determined by their cumulative sum. (See also Bio::Sequence::Common#randomize which creates a new randomized sequence object using the base composition of an existing sequence instance).
counts = {'a'=>1,'c'=>2,'g'=>3,'t'=>4} puts Bio::Sequence::NA.randomize(counts) #=> "ggcttgttac" (for example)
You may also feed the output of randomize into a block
actual_counts = {'a'=>0, 'c'=>0, 'g'=>0, 't'=>0} Bio::Sequence::NA.randomize(counts) {|x| actual_counts[x] += 1} actual_counts #=> {"a"=>1, "c"=>2, "g"=>3, "t"=>4}
Arguments:
-
(optional) hash: Hash object
- Returns
-
Bio::Sequence::NA object
# File lib/bio/sequence/compat.rb, line 82 def self.randomize(*arg, &block) self.new('').randomize(*arg, &block) end
Public Instance Methods
Calculate the ratio of AT / ATGC bases. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga') puts s.at_content #=> 0.444444444444444
- Returns
-
Float
# File lib/bio/sequence/na.rb, line 317 def at_content count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0.0 if at + gc == 0 return at.quo(at + gc) end
Calculate the ratio of (A - T) / (A + T) bases. U is regarded as T.
s = Bio::Sequence::NA.new('atgttgttgttc') puts s.at_skew #=> -0.75
- Returns
-
Float
# File lib/bio/sequence/na.rb, line 345 def at_skew count = self.composition a = count['a'] t = count['t'] + count['u'] return 0.0 if a + t == 0 return (a - t).quo(a + t) end
Returns counts of each codon in the sequence in a hash.
s = Bio::Sequence::NA.new('atggcgtga') puts s.codon_usage #=> {"gcg"=>1, "tga"=>1, "atg"=>1}
This method does not validate codons! Any three letter group is a 'codon'. So,
s = Bio::Sequence::NA.new('atggNNtga') puts s.codon_usage #=> {"tga"=>1, "gnn"=>1, "atg"=>1} seq = Bio::Sequence::NA.new('atgg--tga') puts s.codon_usage #=> {"tga"=>1, "g--"=>1, "atg"=>1}
Also, there is no option to work in any frame other than the first.
- Returns
-
Hash object
# File lib/bio/sequence/na.rb, line 273 def codon_usage hash = Hash.new(0) self.window_search(3, 3) do |codon| hash[codon] += 1 end return hash end
Example:
seq = Bio::Sequence::NA.new('gaattc') cuts = seq.cut_with_enzyme('EcoRI')
or
seq = Bio::Sequence::NA.new('gaattc') cuts = seq.cut_with_enzyme('g^aattc')
See Bio::RestrictionEnzyme::Analysis.cut
# File lib/bio/sequence/na.rb, line 479 def cut_with_enzyme(*args) Bio::RestrictionEnzyme::Analysis.cut(self, *args) end
Returns a new sequence object with any 'u' bases changed to 't'. The original sequence is not modified.
s = Bio::Sequence::NA.new('augc') puts s.dna #=> 'atgc' puts s #=> 'augc'
- Returns
-
new Bio::Sequence::NA object
# File lib/bio/sequence/na.rb, line 423 def dna self.tr('u', 't') end
Changes any 'u' bases in the original sequence to 't'. The original sequence is modified.
s = Bio::Sequence::NA.new('augc') puts s.dna! #=> 'atgc' puts s #=> 'atgc'
- Returns
-
current Bio::Sequence::NA object (modified)
# File lib/bio/sequence/na.rb, line 435 def dna! self.tr!('u', 't') end
Returns a new complementary sequence object (without reversing). The original sequence object is not modified.
s = Bio::Sequence::NA.new('atgc') puts s.forward_complement #=> 'tacg' puts s #=> 'atgc'
- Returns
-
new Bio::Sequence::NA object
# File lib/bio/sequence/na.rb, line 100 def forward_complement s = self.class.new(self) s.forward_complement! s end
Converts the current sequence into its complement (without reversing). The original sequence object is modified.
seq = Bio::Sequence::NA.new('atgc') puts s.forward_complement! #=> 'tacg' puts s #=> 'tacg'
- Returns
-
current Bio::Sequence::NA object (modified)
# File lib/bio/sequence/na.rb, line 114 def forward_complement! if self.rna? self.tr!('augcrymkdhvbswn', 'uacgyrkmhdbvswn') else self.tr!('atgcrymkdhvbswn', 'tacgyrkmhdbvswn') end self end
Calculate the ratio of GC / ATGC bases. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga') puts s.gc_content #=> 0.555555555555556
- Returns
-
Float
# File lib/bio/sequence/na.rb, line 303 def gc_content count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0.0 if at + gc == 0 return gc.quo(at + gc) end
Calculate the ratio of GC / ATGC bases as a percentage rounded to the nearest whole number. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga') puts s.gc_percent #=> 55
- Returns
-
Fixnum
# File lib/bio/sequence/na.rb, line 288 def gc_percent count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0 if at + gc == 0 gc = 100 * gc / (at + gc) return gc end
Calculate the ratio of (G - C) / (G + C) bases.
s = Bio::Sequence::NA.new('atggcgtga') puts s.gc_skew #=> 0.6
- Returns
-
Float
# File lib/bio/sequence/na.rb, line 331 def gc_skew count = self.composition g = count['g'] c = count['c'] return 0.0 if g + c == 0 return (g - c).quo(g + c) end
Returns an alphabetically sorted array of any non-standard bases (other than 'atgcu').
s = Bio::Sequence::NA.new('atgStgQccR') puts s.illegal_bases #=> ["q", "r", "s"]
- Returns
-
Array object
# File lib/bio/sequence/na.rb, line 360 def illegal_bases self.scan(/[^atgcu]/).sort.uniq end
Estimate molecular weight (using the values from BioPerl's SeqStats.pm module).
s = Bio::Sequence::NA.new('atggcgtga') puts s.molecular_weight #=> 2841.00708
RNA and DNA do not have the same molecular weights,
s = Bio::Sequence::NA.new('auggcguga') puts s.molecular_weight #=> 2956.94708
- Returns
-
Float object
# File lib/bio/sequence/na.rb, line 376 def molecular_weight if self.rna? Bio::NucleicAcid.weight(self, true) else Bio::NucleicAcid.weight(self) end end
Generate the list of the names of each nucleotide along with the sequence (full name). Names used in bioruby are found in the Bio::AminoAcid::NAMES hash.
s = Bio::Sequence::NA.new('atg') puts s.names #=> ["Adenine", "Thymine", "Guanine"]
- Returns
-
Array object
# File lib/bio/sequence/na.rb, line 407 def names array = [] self.each_byte do |x| array.push(Bio::NucleicAcid.names[x.chr.upcase]) end return array end
Returns a new sequence object with the reverse complement sequence to the original. The original sequence is not modified.
s = Bio::Sequence::NA.new('atgc') puts s.reverse_complement #=> 'gcat' puts s #=> 'atgc'
- Returns
-
new Bio::Sequence::NA object
# File lib/bio/sequence/na.rb, line 131 def reverse_complement s = self.class.new(self) s.reverse_complement! s end
Converts the original sequence into its reverse complement.
The original sequence is modified.
s = Bio::Sequence::NA.new('atgc') puts s.reverse_complement #=> 'gcat' puts s #=> 'gcat'
- Returns
-
current Bio::Sequence::NA object (modified)
# File lib/bio/sequence/na.rb, line 145 def reverse_complement! self.reverse! self.forward_complement! end
Returns a new sequence object with any 't' bases changed to 'u'. The original sequence is not modified.
s = Bio::Sequence::NA.new('atgc') puts s.dna #=> 'augc' puts s #=> 'atgc'
- Returns
-
new Bio::Sequence::NA object
# File lib/bio/sequence/na.rb, line 447 def rna self.tr('t', 'u') end
Changes any 't' bases in the original sequence to 'u'. The original sequence is modified.
s = Bio::Sequence::NA.new('atgc') puts s.dna! #=> 'augc' puts s #=> 'augc'
- Returns
-
current Bio::Sequence::NA object (modified)
# File lib/bio/sequence/na.rb, line 459 def rna! self.tr!('t', 'u') end
style:
Hash of :tempo, :scale, :tones
scale:
C C# D D# E F F# G G# A A# B 0 1 2 3 4 5 6 7 8 9 10 11
tones:
Hash of :prog, :base, :range -- tone, vol? or len?, octaves
drum:
true (with rhythm part), false (without rhythm part)
# File lib/bio/shell/plugin/midi.rb, line 351 def to_midi(style = {}, drum = true) default = MidiTrack::Styles["Ichinose"] if style.is_a?(String) style = MidiTrack::Styles[style] || default end tempo = style[:tempo] || default[:tempo] scale = style[:scale] || default[:scale] tones = style[:tones] || default[:tones] track = [] tones.each_with_index do |tone, i| ch = i ch += 1 if i >= 9 # skip rythm track track.push MidiTrack.new(ch, tone[:prog], tone[:base], tone[:range], scale) end if drum rhythm = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11] track.push(MidiTrack.new(9, 0, 35, 2, rhythm)) end cur = 0 window_search(4) do |s| track[cur % track.length].push(s) cur += 1 end track.each do |t| t.push_silent(12) end ans = track[0].header(track.length, tempo) track.each do |t| ans += t.encode end return ans end
Create a ruby regular expression instance (Regexp)
s = Bio::Sequence::NA.new('atggcgtga') puts s.to_re #=> /atggcgtga/
- Returns
-
Regexp object
# File lib/bio/sequence/na.rb, line 391 def to_re if self.rna? Bio::NucleicAcid.to_re(self.dna, true) else Bio::NucleicAcid.to_re(self) end end
Translate into an amino acid sequence.
s = Bio::Sequence::NA.new('atggcgtga') puts s.translate #=> "MA*"
By default, translate starts in reading frame position 1, but you can start in either 2 or 3 as well,
puts s.translate(2) #=> "WR" puts s.translate(3) #=> "GV"
You may also translate the reverse complement in one step by using frame values of -1, -2, and -3 (or 4, 5, and 6)
puts s.translate(-1) #=> "SRH" puts s.translate(4) #=> "SRH" puts s.reverse_complement.translate(1) #=> "SRH"
The default codon table in the translate function is the Standard Eukaryotic codon table. The translate function takes either a number or a Bio::CodonTable object for its table argument. The available tables are (NCBI):
1. "Standard (Eukaryote)" 2. "Vertebrate Mitochondrial" 3. "Yeast Mitochondorial" 4. "Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma" 5. "Invertebrate Mitochondrial" 6. "Ciliate Macronuclear and Dasycladacean" 9. "Echinoderm Mitochondrial" 10. "Euplotid Nuclear" 11. "Bacteria" 12. "Alternative Yeast Nuclear" 13. "Ascidian Mitochondrial" 14. "Flatworm Mitochondrial" 15. "Blepharisma Macronuclear" 16. "Chlorophycean Mitochondrial" 21. "Trematode Mitochondrial" 22. "Scenedesmus obliquus mitochondrial" 23. "Thraustochytrium Mitochondrial"
If you are using anything other than the default table, you must specify frame in the translate method call,
puts s.translate #=> "MA*" (using defaults) puts s.translate(1,1) #=> "MA*" (same as above, but explicit) puts s.translate(1,2) #=> "MAW" (different codon table)
and using a Bio::CodonTable instance in the translate method call,
mt_table = Bio::CodonTable[2] puts s.translate(1, mt_table) #=> "MAW"
By default, any invalid or unknown codons (as could happen if the sequence contains ambiguities) will be represented by 'X' in the translated sequence. You may change this to any character of your choice.
s = Bio::Sequence::NA.new('atgcNNtga') puts s.translate #=> "MX*" puts s.translate(1,1,'9') #=> "M9*"
The translate method considers gaps to be unknown characters and treats them as such (i.e. does not collapse sequences prior to translation), so
s = Bio::Sequence::NA.new('atgc--tga') puts s.translate #=> "MX*"
Arguments:
-
(optional) frame: one of 1,2,3,4,5,6,-1,-2,-3 (default 1)
-
(optional) table: Fixnum in range 1,23 or Bio::CodonTable object (default 1)
-
(optional) unknown: Character (default 'X')
- Returns
-
Bio::Sequence::AA object
# File lib/bio/sequence/na.rb, line 232 def translate(frame = 1, table = 1, unknown = 'X') if table.is_a?(Bio::CodonTable) ct = table else ct = Bio::CodonTable[table] end naseq = self.dna case frame when 1, 2, 3 from = frame - 1 when 4, 5, 6 from = frame - 4 naseq.complement! when -1, -2, -3 from = -1 - frame naseq.complement! else from = 0 end nalen = naseq.length - from nalen -= nalen % 3 aaseq = naseq[from, nalen].gsub(/.{3}/) {|codon| ct[codon] or unknown} return Bio::Sequence::AA.new(aaseq) end
Protected Instance Methods
# File lib/bio/sequence/na.rb, line 463 def rna? self.index('u') end